There's More to Evidence than the Evidence
- Mike Gene
The issue of "evidence" comes up again and again in this topic. But we need to distinguish what I would call epistemological evidence (EE) from ontological evidence (OE). EE is about acquiring data that would convince a hardcore skeptic of your position. That is, we ask what we could possibly know that would convince the skeptic. The skeptic comes back with some possible finding (Genesis encoded in DNA as evidence for Intelligent Design) and then, I suppose, it becomes an issue about whether or not such evidence exists.
OE is about acquiring data that would be expected to exist if a hypothesis is true. The data then are the fingerprints of the proposed event. Such data might not convince the skeptic, but that's not relevant if you are trying to conduct an investigation (more on this later).
Let's consider some examples of EE:
Hopefully what can be seen from this list is that while such findings might convince the skeptics, there is no reason to think the demanded evidence is coupled to the truth of the claim being denied. Does the truth of evolution mean we should be able to get a talking monkey by exposing it to x-rays? Does the truth of the carcinogenic nature of smoking mean everyone who smokes will develop cancer? Does the truth of ID mean a Genesis text should be in the DNA? In other words, while such things may satisfy the demand for EE, a concern for OE would never impart significance to them.
EE and OE are really about two different things. The objective behind EE is to generate consensus about claim X. The objective behind OE is to detect fingerprints likely to exist if claim X is true. EE is thus tied to sociology while OE is tied to an investigation.
These are very different objectives which carry different risks. The risk with OE is the generation of false positives, that is, proposing explanation X as valid because it explains facts A, B, and C (i.e., A, B, and C are expected to exist if X is true). The problem here is that another explanation, Y, may also account for facts A, B, and C. Thus, the risk is of proposing a false explanation as one that is valid. The risk is that of making a mistake.
The risk with EE is the generation of false negatives. Because we demand excessive evidence, sufficient to convince the diehard skeptic, we may be demanding things that would not likely follow from the truth of claim X. This is asking for facts M, N, and O when there is no good reason to think such facts would exist given claim X is true. Thus, the risk is of rejecting a valid explanation when it is valid. The risk is that of being afraid to make a mistake (the risk of being unwilling to take a risk).
When it comes to teleological explanations, it seems rather clear that EE is demanded. This is because many subscribe to the notion that "extraordinary claims require extraordinary evidence."
However, the truth of this claim has never been established and no one has ever clarified exactly what is meant by "extraordinary evidence." In fact, it is apparent that "extraordinary evidence" is just EE - something that is supposed to convince a diehard skeptic. This may be an important demand if we are dealing with a sociological phenomena where a community of inquirers places great value on consensus. But what if the need for consensus is actually an obstacle for uncovering a truth that, because of its nature, is inherently ambiguous?
It is crucial that we distinguish between these two types of evidence, as much of the confusion surrounding debates often involves the conflation of these two concepts. And debates generated by proposing teleological causes are no different. Let's consider an example to illustrate this.
While many skeptics can come up with many reasons why they think the standard appeals to design in nature are without evidence, they have great difficulty explaining what type of data would cause them to suspect intelligent design (ID). When pressed, some will acknowledge that they would consider ID a reasonable hypothesis if scientists were to uncover a message encoded in the DNA, such as part of the Book of Genesis. It's nice to know that that such critics would be convinced of ID if only we could find some text from Genesis encoded in the DNA. But I fail to see how this is resolves anything in the real world.
Let's consider various reasons why a Genesis text in the DNA, while capable of convincing the hardcore skeptic, does not necessarily, or even reasonably, follow from ID. To do this, let me use the teleological hypothesis of exogenous seeding, where the first cells were both bioengineered and deposited some 3.5+ billion years ago. Does this hypothesis mean one should be looking for Genesis text in the DNA?
1.The skeptic wants a "nonselectable messages in the genome" because "natural selection could not have favored" it (BTW, showing how many non-teleologists demand evidence against RM&NS as evidence for ID). But what type of designer would endow the original cells with such a message? It would seem one that wanted very badly to be acknowledged as the designer. Do we have any basis to assume this about the designer? And without that assumption, why expect such a message?
2. The fatal flaw in this demand, with regard to my hypothesis, is that any "nonselectable messages in the genome" would have decayed away a long, long time ago. A basic understanding of the nature of mutation and the importance of selection dictates this. In fact, we might expect life's designers to be quite aware of this, meaning that they would never have bothered to insert such a message in any genome.
3. Let's go beyond my hypothesis and consider a generic designer who might intervene at any time in life's history. In this case, the assumptions we have to make about the designer become more numerous. This is because a designer wanting to be recognized as a designer may very well have designed pigment-producing cells to spell out the message on the designed creatures forehead. A message written in the DNA would be a message targeted to a specific population of people (scientists and technicians), meaning the designer is trying to specifically communicate with this group. And how in the world does one justify that assumption about any designer?
4. Let's assume the designer wants to communicate with this special group. There remains a very real problem - how do you do this? To illustrate this, I've encoded a text from Genesis in the language of nucleic acids and provide the following fragment that contains the message:
GGCGUGAACAAUGUCCCAUGAGACGUAUGCACUGCUGAAACC
AGUGAUGCCAAGUAAUGUCGAGAAACUGCUUUCACAUUCUCU
UUUAGAUGUGCCAGUGCCCCAUGACCGACGUAUUCUGCCCA
AUGGACGCGUUUCUACAAUUAACACACUGCCCCAUGUAAUU
CCACAUUCAAGUCCUUUUCCAUUUCUUCCACUA
Here's the problem:
a. Even if a message existed, and somehow, someone was likely to have sequenced it (because we don't know what organisms are supposed to have the message), how would you recognize that this strand was encoding a message? Is this something genome sequencers would detect?
b. More importantly, even if you suspected there was some message in this strand, how would you demonstrate it? Here's a challenge for any skeptic: tell me what verse from Genesis is encoded in the message. You have many advantages working for you: You know there is a message there; you know the message is something from Genesis; and you know we speak the same language, thus some English sentence is coded. So what is it?
The problem is that codes are conventional. Just because I can assign a nucleotide sequence to represent a letter of the English alphabet does not mean you are able to decode it without me telling you the convention I used.
Now, if the skeptic cannot decode the message above, why in the world would anyone think a scientist could decode a message from a non-human designer? What language did they encode? What convention did they employ?
6. Even if by some stroke of genius and/or luck, we were to find some message encoded in the genome, it is not clear to me that the skeptic would not simply move the goal posts.
a. The skeptic could argue that all we have shown is that some intelligent agent encoded a message in the genome. But this does not extrapolate to mean that the intelligent agent designed anything else in the cell.
b. One could adopt another common complains by ID, and argue that an ID inference here is anti-science. This "message" would simply be another challenge for science; the job of science would now be to explain how this "designoid" message came into existence through non-teleological means.
Thus, it's not clear even this type of data would satisfy the demands of EE.
In the end, we can see that while a Genesis text in the genome would constitute extraordinary evidence and perhaps convince the skeptic, these data would not be expected if the first cells were indeed bioengineered and used to seed this planet. In other words, EE is not OE. Thus, the failure to find such a text is meaningless. It is not evidence against a teleological cause. And the failure provides not the slightest reason to think a teleological explanation is "without evidence."
Thus, when someone says a teleological explanation is "without evidence," do they mean EE or OE? Do they merely mean that there is nothing that convinces hard core skeptics such as themselves? Or do they mean there are no data in the world that would be expected to exist had life been designed?
I find it is almost always the former, in which case, a "so what?" test has not been passed.